Exahel Castaneda, Floricela Bravo, JoAnna Chaclan, Kevin Cruz, Brandon Gonzalez, Juan Mendoza,, Camilo Samano, and Carolina Torres – Cross Keys High School, Atlanta, Georgia, United States of America
Reviewed on 4 May 2024; Accepted on 10 June 2024; Published on 26 October 2024
With help from the 2024 BioTreks Production Team.
Perfluoroalkyl compounds known as PFAS are a type of microplastic known as “forever chemicals.” Exposure to PFAS can cause various adverse health effects. PFAS are found in several industrial products and the environment, including the drinking water supply. This project proposes constructing a transgenic bacterial system to degrade PFAS in the water supply into harmless organic material. The first step into engineering this biological system is to test its promoter, which is known to be activated in the presence of PFAS using a reporter green fluorescent protein (eGFP) gene. This will be followed by testing the ability of enzymes DeHa 1 and DeHa 2 to degrade the PFAS. After the PFAS are eliminated, the next step is to determine if the bacteria can be eliminated by activating the self-destruct gene RhaS under the arabinose promoter. The final step, after successfully removing PFAS and bacteria, is to integrate this system into the water processing treatment. The authors hope that, with their system, they can help alleviate the negative effects of PFAS exposure by eliminating them from the water system.
Keywords: PFAS, perfluoroalkyl compounds, microplastics, water supply, synthetic biology
Authors are listed in alphabetical order. Ana White mentored the group. Please direct all correspondence to ana_m_white@dekalbschoolsga.org.
Background
Per- and polyfluoroalkyl substances (PFAS) are known as “forever chemicals” due to their resistance to breakdown under normal environmental conditions. PFAS are man-made chemicals consisting of carbon fluorine chains with bonds that are very difficult to break (Manojkumar et al., 2023). PFAS have been used since the 1940s and 1950s and have been used widely in many consumer products and industrial applications (Kowalska et al., 2023; Wisconsin Department of Health Services, 2018; U.S. EPA, 2024; Figure 1). There are over 5,000 PFAS of man-made products that are commonly used because of their oil and water resistant properties, making them both hydrophilic and hydrophobic (Illinois Environmental Protection Agency, n.d.; Kowalska et al., 2023). In addition, PFAS are so small that they can pass through the water filtration process system (Amen et al., 2023). PFAS can cause adverse health effects, such as thyroid disruption, liver damage, and cardiovascular disease depending on individual factors and type of exposure (Fenton et al., 2020; Figure 2). Every day researchers are discovering more and more adverse effects to humans and animals linked to PFAS exposure.
| Figure 1. Some of the places where PFAS can be found. Otherwise, PFAS are ubiquitous in the environment. |
|
|---|
| Figure 2. Some of the potential negative effects of PFAS in the human body. However, researchers are continuously identifying additional adverse effects from exposure to PFAS (Science, 2022). |
|
|---|
Current filtration protocols, like reverse osmosis and ion exchange, have been shown to be effective at removing PFAS from the water (Amen et al., 2023). However, reverse osmosis has limits. The process is extremely slow while using lots of water and energy. Furthermore, reverse osmosis faces additional limitations such as removing healthy minerals like calcium, potassium, and magnesium when it comes to large-scale filtration (Pace, n.d.).
These microplastics have become prevalent in the environment. PFAS can be found in the air, water, and soil. Because of this, the authors’ goal is to eliminate PFAS from the water supply. They have designed a bacterial system to degrade PFAS in water at a large scale and then induce the bacterial system to self-destruct.
Systems level
The overall objective is to develop a biological system to remove PFAS found in drinking water during water treatment. Escherichia coli (E. coli) is the chassis that will be engineered to respond to the presence of PFAS, activating the expression of enzymes that degrade them. Subsequently, they will be able to then activate the chassis self-destruction under the presence of arabinose. The first objective of this project is to develop a biological system using enzymes that are activated when exposed to PFAS that will result in their degradation. The second objective of this project is to design the biological system to self-destruct after the degradation of these compounds.
Device level
The purpose of this project is to design a system that eliminates PFAS from drinking water by engineering a bacterium E. coli DH5α that contains a plasmid activated by exposure to PFAS, thus expressing the enzymes and degrading PFAS into harmless organic compounds. The implementation of this system will be constructed and tested in three phases: testing the activity of the promoter, testing the efficacy of the enzymes (Figure 3A), and testing the destruction of this system by activating the kill-switch gene, RhaS, once the degradation of these forever chemicals in the water has been observed (Figure 3B).
The first objective is to test the efficacy of the promoter, prmA , which is known to be activated in the presence of PFAS (Young et al., 2021). The authors will insert their promoter in the EGFP-PBAD (Addgene plasmid # 54762) plasmid containing an enhanced green fluorescent protein (eGFP). The authors will use the T7 promoter that is already inserted into the plasmid to activate expression of the eGFP gene for the positive control for this assay. For the experimental construct, they replaced the T7 promoter with the prmA promoter (Figure 4).
In the second step, the authors want to test their PFAS-degrading enzymes, dehalogenase 1 and 2, which are thought to break the carbon-fluorine bonds.However, the exact pathway is currently being investigated (Harris et al., 2022;WP_011137954.1, BBaK3347002; Figure 5).. For this phase, the researchers will create three constructs: one to test the activity of dehalogenase 1 (Figure 5A), a second one to test the activity of dehalogenase 2 (Figure 5B), and a third construct to test the activity of both enzymes together (Figure 5C). The objective of this step is to measure the effectiveness of the enzymes in breaking down PFAS by quantifying the amount of PFAS that are left in the system versus the amount of PFAS inserted that are broken down.
The third step of constructing this system aims to initiate a self-destruct protocol to eliminate the bacteria from the water supply. For this construct, the researchers will add the kill-switch gene, rhaS, , which ensures that the biological system will be inactivated after the degradation of PFAS (Meisner & Goldberg, 2016). The kill-switch gene will be under the pBAD promoter that can be activated in the presence of arabinose (Figure 6).
Once this biologically-engineered system has successfully eliminated PFAS from the water supply, the authors aim to eliminate their biological system from the water supply. The first part of this step is to activate the kill-switch gene, which instructs the bacteria to self-destruct. Secondly, they propose to integrate their system into the water processing system after the coagulation process, which neutralizes fine particles by clumping them together. At this time, the system will degrade PFAS and then be induced to self-destruct. This step occurs before the flocculation process, in which flocculants added to the water bind smaller particles together and form larger, heavier particles that will settle to the bottom (ChemREADY, 2024). These will be easier to remove. The filtration and disinfection of the water processing treatment will further clear the water of any bacterial remnants (Figure 7).
Parts level
The proposed biological system aims to first validate a promoter that is known to be activated in the presence of PFAS (BBa_K2911000). The second objective is to test enzymatic activity by measuring the degradation of PFAS. Lastly, in order to eliminate the bacterial system from the water, a self-destruct protocol will be activated using a promoter that responds to the presence of arabinose. This final step ensures that the bacterial system is then removed from the water processing. The final product showing how the plasmid will look is depicted in Figure 8. All constructs will be transformed into DH5α bacteria cells, which are a type E. coli. DH5α cells are genetically modified cells engineered by Douglas Hanahan in the 1980’s that significantly increase transformation efficiency (Wert, 2024).
| Figure 8. Components and map of the EGP-PBAD plasmid (Addgene plasmid # 54762) with the addition of prmA, DeHa 1/2, and rhaS. All vectors for the proposed plasmids were constructed using Benchling. |
|
|---|
The first step is to engineer the EGFP-PBAD plasmid (Addgene plasmid # 54762) by inserting a promoter (prmA) that is known to be activated in the presence of PFAS (Young et al., 2021). The EGFP-PBAD plasmid contains a T7 promoter that, when activated by ITPG, will activate expression of a reporter gene known asenhanced green fluorescent protein (eGFP). This will be the positive control. Next the researchers will replace the T7 promoter with the prmA promoter to test the activation of the reporter gene in the presence of PFAS (BBa_K2911000). This will be the experimental construct.
For the experimental construct, the authors will genetically engineer the EGFP-PBAD plasmid as a vector by removing the T7 promoter and replacing it with their promoter, prmA, by double digest. Their prmA insert will be produced by PCR of a plasmid with the promoter, pSRKBB (Young et al., 2021). Their PCR primers are designed with flanking restriction enzymes BmtI and XhoI (Table 1). After double digestion of the PCR product 194 base pair (Table 2) and the vector EGFP-PBAD with the same restriction enzymes, the researchers will ligate them together creating their new construct, EGFP-PBAD-prmA plasmid (Figure 9). Construction and simulation of double digestion and PCR were carried out on Benchling.
Table 1. Modified primers for prmA with the addition of restriction enzymes flanking the promoter, Bmtl at the 5’ end and Xhol at the 3’ end of the promoter (Young et al.,2021).
| Primer Specification | Sequence |
|---|---|
| prmA F BmtI | 5’ GCATGCTAGCgagggcgtgatggtctgc 3’ |
| prmA R XhoI | 5’ GCATCTCGAGtgtgcgcctcctggatcgtg 3’ |
Table 2. Sequences of construction for the PFAS biological system. PrmA promoter (Young et al.,2021); Enzymes for the degradation of PFAS, dehalogenases 1 and 2 (DeHa 1 & DeHa 2; Harris et al. 2022); Kill-switch gene, rhaS for the destruction of the bacteria (Meisner J. et al. 2016).
| Parts | Sequence |
|---|---|
| prmA | gagggcgtgatggtctgccgcggcgcggggcaagtgtaggcagccaccgcccactcggaagtgacctgcgtctcacactgagacgaatgagagctggctcacggggttcaatcaatttccacaacgtccccccacagccggcacccggccggctcacgatccaggaggcgcaca |
| DeHa 1 | atgctgcgcctgagcgattttgatgcggtgacctttgatgtgtatggcaccctgattgattgggaaccgagcattgtggcgtttctgagcgaatgggcgggcgaactgggcgtgaaagcgagcggcgaagatctgattatgagctttgatcgcgcgcgcgcggaaattcagaaagaacgcccggcgcatctgtatccggaagtgctgcgccgctgctttaaccgcattagcggcgaatttggcgtggcggtggatgcggcgcgccgcgaagcgtttagcaaaaccccgcatcagtggccggcgtatagcgataccagcgcgggcctgaaagcgctgcaagcgcgcgcgcgcattggcgcgctgagcaacattgataacgcgagcctggcgagcagctgcaaaaacatggatattgaatttgatattgtggtgaccgcggaacgcgtgggcgcgtataaaccgagctgggaacattttaacaccgcgattgcggaactggaaggcatgggcattccgcgcgaacgcattctgcatgtgggccagagcctgcgcgcggatattaccccggcgaacaaactgggcctgaaaagcgcgtggattaaccgcccgcagcgcctgctgggcctgagcggcgaaggcgcggcggaagcgcgcccggatctgaccgtggaaagcctggcggaactgctgaaagcgattggctaa |
| DeHa 2 | atgaaaaagattgaagccatcgcgtttgacatgtatgggacactgtatgatgtccattcagttgttgatgcgtgtgaaaaacaatacccaggtaaggggaaagatattagtgtgttatggcgtcagaaacaattggaatatgcgtggttacgttgccttatgggccagtacatcaagttcgaagaagccactgcgaatgcgcttacttacacttgcaaccagatgaaactggactgtgatgaaggcagtgcaatgcgcttgaccgaggaataccttcgcttaaagccattcccagaggtacgcggcgccttgcgtgcacttcgtcagcgcgggatgcgcttggctattttgtctaatggcagcaccgagactattcacgacgtggttcacaactctggcgtagagggggagtttgagcatctgatttctgtagattcggcacgtgcatataaaccgcaccctcttgcgtatgagttaggggaggaggcgttcggaatttcgcgcgagtccatcttgttcgtaagctccaacccctgggacgtaagcggtgcgaaggcgtttggataccaagtttgttggatcaaccgctacggctttgctttcgatgaattgggacaaacccccgatttcactgtccctgtcatggacgcaattgtacatctgatcgccgtacgctga |
| rhaS | ttattgcagaaagccatcccgtccctggcgaatatcacgcggtgaccagttaaactctcggcgaaaaagcgtcgaaaagtggttactgtcgctgaatccacagcgataggcgatgtcagtaacgctggcctcgctgtggcgtagcagatgtcgggctttcatcagtcgcaggcggttcaggtatcgctgaggcgtcagtcccgtttgctgcttaagctgccgatgtagcgtacgcagtgaaagagaaaattgatccgccacggcatcccaattcacctcatcggcaaaatggtcctccagccaggccagaagcaagttgagacgtgatgcgctgttttccaggttctcctgcaaactgcttttacgcagcaagagcagtaattgcataaacaagatctcgcgactggcggtcgagggtaaatcattttccccttcctgctgttccatctgtgcaaccagctgtcgcacctgctgcaatacgctgtggttaacgcgccagtgagacggatactgcccatccagctcttgtggcagcaactgattcagcccggcgagaaactgaaatcgatccggcgagcgatacagcacattggtcagacacagattatcggtatgttcatacagatgccgatcatgatcgcgtacgaaacagaccgtgccaccggtgatggtatagggctgcccattaaacacatgaatacccgtgccatgttcgacaatcacaatttcatgaaaatcatgatgatgttcaggaaaatccgcctgcgggagccgggg |
| Figure 9. Proposed promoter, prmA ligated into EGFP-PBAD plasmid. |
|
|---|
The next step is to design the vector with the PFAS degrading enzymes, dehalogenase I and II genes (BBa_K3347004; BBa_K3347002; Harris et al. 2022; Table 2). . The researchers plan to test the enzymes separately and together to determine their efficacy in defluorinating PFAS or breaking down PFAS into harmless chemicals.
The final step in engineering this system is to insert the rhaS gene, which is the kill-switch gene that instructs the bacterial system to self-destruct. The rhaS gene will be designed to activate the expression of the kill-switch gene in the presence of arabinose under the PBAD promoter. The kill-switch activation is the first step to eliminating the bacteria after its job of breaking down PFAS into harmless organic material has been completed.
Safety
Cell culture
E. coli is commonly used in scientific research. Protein expression in E. coli should be performed at Biosafety Level 1 (BSL1). To prevent contamination, before any lab experiment is performed, one should ensure that the workspace is clean and sterilized by wiping it down with 70% ethanol. Additionally, personal protective equipment (PPE) should be worn at all times and proper protocol should be followed according to the guidelines. Upon completion, all bacterial cultures must be properly disposed of. Bacteria is typically disposed of by autoclave, or if an autoclave is not available, with a 10% bleach solution to kill the bacteria (Addgene Protocols, n.d.)
Water treatment safety
The proposed PFAS-engineered system includes self-destruction of the bacteria after the degradation of PFAS. To further ensure that bacterial remnants are removed from the water supply, the authors propose the insertion of the PFAS system into the second stage of the water processing system (Figure 7). The researchers believe that the second stage is a good place to introduce their transgenic system because the system will have time to destroy PFAS before being introduced into the later stages of the water processing system (CDC, 2022). It is in the later stages in which all the remains of the system will be destroyed with chemicals and filters. Having the bioengineered system self-destruct is one scenario that the authors have been investigating in which the system would have to be replenished. Alternatively, one could find a way to harvest the system after degradation of PFAS and then reuse it. In conclusion, this PFAS bacterial system is first engineered to degrade PFAS into harmless organic materials, which can then be induced to self-destruct. Lastly, through the water treatment process, the bacteria will be safely removed from the water supply.
Discussions
Science-based research is constantly being updated with new reports describing health threats from exposure to these “forever chemicals.” PFAS are difficult to eliminate due to their ubiquitous nature in the environment, and they bypass most cleaning stages of the water purification system. This makes humans more susceptible to PFAS intake, which impacts health.
PFAS are now considered public health risks. To protect the communities, the Biden-Harris administration with the Environmental Protection Agency (EPA) are now establishing rules and ways to regulate the amount of PFAS in the environment (U.S. EPA, 2024).
PFAS are a public health issue that needs to be addressed. Due to the current water treatment’s inability to eliminate PFAS from the water supply, it is important for to develop a system that can safely remove PFAS. The authors are proposing a system that can be utilized in water treatment facilities.
Next steps
For their next steps, the researchers will test the promoter, prmA. For this step, they will have two constructs: EGFP-PBAD, their control construct that contains the T7 promoter with EGFP gene, and their experimental construct that replaces the T7 promoter with the prmA PFAS promoter. After transforming the construct into DH5α cells, their positive control bacteria will be activated with ITPG to see if the experiment will fluoresce. Then they will activate their experimental contruct with PFAS.
One problem the authors foresee is an adequate way to measure PFAS. Currently, liquid chromatography with tandem mass spectrometry is the most accurate way to measure the level of PFAS in the water system (Rehman et al., 2023). Although it is one of the most common ways to measure PFAS, one major problem with this is that it can be quite expensive. Due to financial constraints, the researchers will need to find an alternative method to measure PFAS.
Author contributions
This research project was conceived and developed by A.W.’s Advanced Placement Biology class, which was a group effort. E.C. was responsible for the plasmid designs, writing the systems level, and device level with the help of F.B. E.C. was also responsible for the writing of the parts level. Most of the background information was collected and written by J.M. with the help of K.C. The discussion was written primarily by B.G. with help from J.M. Both B.G. and J.M. wrote the safety section, while C.S. assisted in the research of the water treatment plants and the associated figure.
Acknowledgements
This project was accomplished through the participation of BioBuilderClub, which was embedded into our research class under the supervision of Ana White. We thank BioBuilderClub’s Natalie Kuldell and Chloe Franklin for their patience and support throughout this process. We would also like to give special thanks to Janet Standeven and Dr. Saad Bhamla from Frugal Science at Georgia Tech, who assisted and supported the development of our project. Lastly, we acknowledge our BioBuilderClub mentor, Dr. Michael Sheets, Sunflower Therapeutics, for guiding us with our project design.
References
Addgene Protocols.(n.d.). Lab safety for biosafety levels one and two. https://www.addgene.org/protocols/lab-safety/
Amen, R., Ibrahim, A., Shafqat, W., & Hassan, E. B. (2023). A critical review on PFAS removal from water: Removal mechanism and future challenges. Sustainability, 15(23), 16173. https://doi.org/10.3390/su152316173
CDC. (2022). Water Treatment. Centers for Disease Control and Prevention. https://www.cdc.gov/healthywater/drinking/public/water_treatment.html
Wisconsin Department of Health Services. (2018). Chemicals: Perfluoroalkyl and polyfluoroalkyl (PFAS) substances. . ). Wisconsin Department of Health Services. https://www.dhs.wisconsin.gov/chemical/pfas.htm#:~:text=Perfluoroalkyl%20and%20polyfluoroalkyl%20substances%2C%20or
ChemREADY (n.d.). What is flocculation? ChemREADY: The Clear Choice for Water ClarityTM. https://www.getchemready.com/water-facts/what-is-flocculation/#:~:text=In%20water%20and%20wastewater%20treatment,water%20by%20sedimentation%20or%20filtration.
EGFP-pBAD was a gift from Michael Davidson (Addgene plasmid # 54762; http://n2t.net/addgene:54762; RRID: Addgene_54762).
Environmental Protection Agency. (2023). Our current understanding of the human health and environmental risks of PFAS. United States Environmental Protection Agency. https://www.epa.gov/pfas/our-current-understanding-human-health-and-environmental-risks-pfas#:~:text=Increased%20risk%20of%20some%20cancers,and%2For%20risk%20of%20obesity.
Fenton, S. E., Ducatman, A., Boobis, A., DeWitt, J. C., Lau, C., Ng, C., Smith, J. S., & Roberts, S. M. (2020). Per‐ and Polyfluoroalkyl Substance Toxicity and Human Health Review: Current State of Knowledge and Strategies for Informing Future Research. Environmental Toxicology and Chemistry, 40(3), 606–630. https://doi.org/10.1002/etc.4890
Harris, J. D., Coon, C. M., Doherty, M. E., McHugh, E. A., Warner, M. C., Walters, C. L., Orahood, O. M., Loesch, A. E., Hatfield, D. C., Sitko, J. C., Almand, E. A., & Steel, J. J. (2022). Engineering and characterization of dehalogenase enzymes from Delftia acidovorans in bioremediation of perfluorinated compounds. Synthetic and Systems Biotechnology, 7(2), 671–676. https://doi.org/10.1016/j.synbio.2022.02.005
iGEM. (n.d.). Registry of Standard Biological Parts. iGEM. https://parts.igem.org/Main_Page
Isaacs-Thomas, B. (2022). Why getting PFAS out of our products is so hard – and why it matters. PBS. https://www.pbs.org/newshour/science/pfas-are-everywhere-what-can-we-do-to-change-that#:~:text=Existing%20evidence%20suggests%20that%20high
Kowalska, D., Sosnowska, A., Bulawska, N., =Stępnik, Besselink, H., Behnisch, P. A., & Puzyn, T. (2023). How the structure of per- and polyfluoroalkyl substances (PFAS) influences their binding potency to the peroxisome proliferator-activated and thyroid hormone receptors—An in silico screening study. Molecules, 28(2), 479–479. https://doi.org/10.3390/molecules28020479
Manojkumar, Y., Pilli, S., Rao, P. V., & Tyagi, R. D. (2023). Sources, occurrence and toxic effects of emerging per- and polyfluoroalkyl substances (PFAS). Neurotoxicology and Teratology, 97, 107174. https://doi.org/10.1016/j.ntt.2023.107174
Meisner, J., & Goldberg, J. B. (2016). The Escherichia coli rhaSR-PrhaBAD inducible promoter system allows tightly controlled gene expression over a wide range in Pseudomonas aeruginosa. Applied and Environmental Microbiology, 82(22), 6715–6727. https://doi.org/10.1128/AEM.02041-16
Pace, M. (n.d.). Does Reverse Osmosis Remove Minerals? Aquasana. https://www.aquasana.com/info/does-reverse-osmosis-remove-minerals-pd.html#:~:text=During%20reverse%20osmosis%20filtration%2C%20healthy
Rehman, A. U., Tse, W. K. F., Sun, H., Kim, S.-K., Li, F., Arvaniti, O. S., Plumlee, M. H., Yu, J., Takagi, S., Deng, S., Wang, F., Liu, X., Szostek, B., Górecki, T., Namiesnik, J., & Carnero, A. R. (2023). Current and emerging analytical techniques for the determination of PFAS in environmental samples. Trends in Environmental Analytical Chemistry, 37, e00198. https://doi.org/10.1016/j.teac.2023.e00198
United States Environmental Protection Agency. (2024). Biden-Harris administration finalizes critical rule to clean up PFAS contamination to protect public health. United States Environmental Protection Agency. https://www.epa.gov/newsreleases/biden-harris-administration-finalizes-critical-rule-clean-pfas-contamination-protect
Wert J. (2024). Strain- DH5α: The coli genetic stock center. Yale University. https://cgsc2.biology.yale.edu/Strain.php?ID=150015
Young, N. A., Lambert, R. L., Buch, A. M., Dahl, C. L., Harris, J. D., Barnhart, M. D., Sitko, J. C., & Steel, J. J. Perfluoroalkyl Substance (2021). A synthetic biology approach using engineered bacteria to detect perfluoroalkyl substance (PFAS) contamination in water. Military Medicine, 186(1), 801–807. https://doi.org/10.1093/milmed/usaa367
